| reported seq | reported name | reference |
|---|---|---|
| GTACGTGTTATAAAACGTGT | WARBNEXTA | [ref] |
| AAKAATWYRTAWATAAAAMTTTTATWTA | COREOS | [ref] |
| |
|
| GO ID | term | -Log(p) | number of {A; genes in a GO} | numver of {B; genes with this heptamer} | {A} x {B} |
|---|---|---|---|---|---|
| no functional bias detected | |||||
| correl | TF | function ((alias))* | TF family (link to AGRIS) |
|---|---|---|---|
| -0.62 | At1g14410 | DNA-binding protein-related | WHIRLY |
| 0.61 | At3g52800 | zinc finger (AN1-like) family protein | C2H2 |
| -0.59 | At1g71260 | expressed protein | WHIRLY |
| -0.58 | At3g52910 | expressed protein | GRF |
| 0.57 | At1g08320 | bZIP family transcription factor | bZIP |
| -0.57 | At3g22780 | CXC domain protein (TSO1) ((TSO1)) | CPP |
| 0.56 | At1g62300 | WRKY family transcription factor ((WRKY6)) | WRKY |
| 0.56 | At3g19580 | zinc finger (C2H2 type) protein 2 (AZF2) ((AZF2)) | C2H2 |
| 0.55 | At3g43430 | zinc finger (C3HC4-type RING finger) family protein | C3H |
| 0.55 | At5g04340 | zinc finger (C2H2 type) family protein ((C2H2)) | C2H2 |
| 0.54 | At5g66070 | zinc finger (C3HC4-type RING finger) family protein | C3H |
| 0.54 | At2g38470 | WRKY family transcription factor ((WRKY33)) | WRKY |
| -0.53 | At4g04890 | homeobox-leucine zipper protein protodermal factor 2 (PDF2) ((PDF2)) | Homeobox |
| 0.53 | At3g04060 | no apical meristem (NAM) family protein | NAC |
| 0.53 | At5g63790 | no apical meristem (NAM) family protein | NAC |
|