reported seq | reported name | reference |
---|---|---|
ATAATGGGCCACACTGTGGGGCAT | SE1PVGRP18 | [ref] |
![]() |
![]() |
GO ID | term | -Log(p) | number of {A; genes in a GO} | numver of {B; genes with this heptamer} | {A} x {B} |
---|---|---|---|---|---|
no functional bias detected |
correl | TF | function ((alias))* | TF family (link to AGRIS) |
---|---|---|---|
0.63 | At4g30930 | 50S ribosomal protein L21, mitochondrial (RPL21M) ((WRKY32)) | WRKY |
0.60 | At1g71260 | expressed protein | WHIRLY |
0.57 | At3g57150 | dyskerin, putative / nucleolar protein NAP57, putative ((NAP57)) | NAC |
0.56 | At5g16070 | chaperonin, putative | TCP |
0.50 | At1g14410 | DNA-binding protein-related | WHIRLY |
0.50 | At2g02740 | transcription factor, putative | WHIRLY |
0.49 | At3g52910 | expressed protein | GRF |
-0.49 | At3g02340 | zinc finger (C3HC4-type RING finger) family protein | C3H |
0.47 | At1g27050 | homeobox-leucine zipper family protein | Homeobox |
0.47 | At5g02470 | DP-2 transcription factor, putative (DPA) ((DPA)) | E2F-DP |
-0.46 | At2g37150 | zinc finger (C3HC4-type RING finger) family protein | C3H |
-0.46 | At1g19310 | zinc finger (C3HC4-type RING finger) family protein | C3H |
0.45 | At1g72050 | zinc finger (C2H2 type) family protein | C2H2 |
0.42 | At3g16870 | zinc finger (GATA type) family protein | C2C2-Gata |
0.42 | At2g24500 | zinc finger (C2H2 type) family protein ((FZF)) | C2H2 |
|