| reported seq | reported name | reference |
|---|---|---|
| GTACGTGTTATAAAACGTGT | WARBNEXTA | [ref] |
| AACGTG | T/GBOXATPIN2 | [ref] |
| ACGTG | ABRELATERD1 | [ref] |
| ACGT | ACGTATERD1 | [ref] |
| |
|
| GO ID | term | -Log(p) | number of {A; genes in a GO} | numver of {B; genes with this heptamer} | {A} x {B} |
|---|---|---|---|---|---|
| no functional bias detected | |||||
| correl | TF | function ((alias))* | TF family (link to AGRIS) |
|---|---|---|---|
| 0.60 | At1g32640 | basic helix-loop-helix (bHLH) protein (RAP-1) ((ATMYC2)) | BHLH |
| 0.56 | At2g46510 | basic helix-loop-helix (bHLH) family protein | BHLH |
| 0.55 | At4g17230 | scarecrow-like transcription factor 13 (SCL13) | GRAS |
| 0.54 | At1g43160 | AP2 domain-containing protein RAP2.6 (RAP2.6) | AP2-EREBP |
| 0.53 | At5g67300 | myb family transcription factor | MYB |
| 0.51 | At5g17490 | gibberellin response modulator, putative / gibberellin-responsive modulator, putative ((RGL3)) | GRAS |
| 0.50 | At4g05100 | myb family transcription factor (MYB74) | MYB |
| 0.50 | At4g27410 | no apical meristem (NAM) family protein (RD26) ((RD26)) | NAC |
| 0.48 | At3g15210 | ethylene-responsive element-binding factor 4 (ERF4) ((ATERF4, RAP2.5)) | AP2-EREBP |
| 0.47 | At2g38250 | DNA-binding protein-related | Trihelix |
| 0.47 | At1g28370 | ERF domain protein 11 (ERF11) | AP2-EREBP |
| 0.47 | At3g52800 | zinc finger (AN1-like) family protein | C2H2 |
| 0.46 | At1g22810 | AP2 domain-containing transcription factor, putative | AP2-EREBP |
| 0.46 | At1g18710 | myb family transcription factor (MYB47) | MYB |
| 0.46 | At1g19310 | zinc finger (C3HC4-type RING finger) family protein | C3H |
|